miRDeep2

miRDeep home

Parameters used


miRDeep2 version2.0.0.4
Program call/Users/vikas0633/Desktop/plant/2012_week22/mirdeep2/miRDeep2.pl miRNA lj_r25_demo.fa miRNA.arf /Users/vikas0633/Desktop/plant/2012_week28/shortran_0.43/demo/annotation_files/ath_mature.fa /Users/vikas0633/Desktop/plant/2012_week28/shortran_0.43/demo/annotation_files/lja_mature.fa /Users/vikas0633/Desktop/plant/2012_week28/shortran_0.43/demo/annotation_files/ath_stem_loop.fa
ReadsmiRNA
Genomelj_r25_demo.fa
MappingsmiRNA.arf
Reference mature miRNAs/Users/vikas0633/Desktop/plant/2012_week28/shortran_0.43/demo/annotation_files/ath_mature.fa
Other mature miRNAs/Users/vikas0633/Desktop/plant/2012_week28/shortran_0.43/demo/annotation_files/lja_mature.fa


Survey of miRDeep2 performance for score cut-offs -10 to 10
novel miRNAsknown miRBase miRNAs
miRDeep2 scorefor details on how the log-odds score is calculated, see Friedlander et al., Nature Biotechnology, 2008. predicted by miRDeep2novel miRNA hairpins are here defined by not having any of the reference mature miRNAs mapping perfectly (full length, no mismatches). The numbers show how many novel miRNA hairpins have a score equal to or exceeding the cut-off. estimated false positivesnumber of false positive miRNA hairpins predicted at this cut-off, as estimated by the miRDeep2 controls (see Friedlander et al., Nature Biotechnology, 2008). Mean and standard deviation is estimated from 100 rounds of permuted controls. estimated true positivesthe number of true positive miRNA hairpins is estimated as t = total novel miRNAs - false positive novel miRNAs. The percentage of the predicted novel miRNAs that is estimated to be true positives is calculated as p = t / total novel miRNAs. The number of false positives is estimated from 100 rounds of permuted controls. In each of the 100 rounds, t and p are calculated, generating mean and standard deviation of t and p. The variable p can be used as an estimation of miRDeep2 positive predictive value at the score cut-off. in speciesnumber of reference mature miRNAs for that species given as input to miRDeep2. in datanumber of reference mature miRNAs for that species that map perfectly (full length, no mismatches) to one or more of precursor candidates that have been excised from the genome by miRDeep2. detected by miRDeep2number of reference mature miRNAs for that species that map perfectly (full length, no mismatches) to one or more of predicted miRNA hairpins that have a score equal to or exceeding the cut-off. The percentage of reference mature miRNAs in data that is detected by miRDeep2 is calculated as s = reference mature miRNAs detected / reference mature miRNAs in data. s can be used as an estimation of miRDeep2 sensitivity at the score cut-off. estimated signal-to-noisefor the given score cut-off, the signal-to-noise ratio is estimated as r = total miRNA hairpins reported / mean estimated false positive miRNA hairpins over 100 rounds of permuted controls. excision gearingthis is the minimum read stack height required for excising a potential miRNA precursor from the genome in this analysis.
1000 ± 00 ± 0 (0 ± 0%)144122 (100%)0.71
900 ± 00 ± 0 (0 ± 0%)144122 (100%)0.71
812 ± 10 ± 0 (26 ± 44%)144122 (100%)1.31
712 ± 10 ± 0 (24 ± 43%)144122 (100%)1.21
612 ± 10 ± 0 (21 ± 41%)144122 (100%)1.11
512 ± 20 ± 0 (20 ± 40%)144122 (100%)11
412 ± 20 ± 0 (18 ± 39%)144122 (100%)11
312 ± 20 ± 0 (14 ± 35%)144122 (100%)0.91
242 ± 22 ± 1 (44 ± 34%)144122 (100%)21
1233 ± 220 ± 2 (85 ± 8%)144122 (100%)6.91
04514 ± 331 ± 3 (70 ± 8%)144122 (100%)3.41
-16236 ± 626 ± 6 (43 ± 9%)144122 (100%)1.81
-27259 ± 813 ± 8 (18 ± 11%)144122 (100%)1.21
-39088 ± 105 ± 7 (6 ± 7%)144122 (100%)11
-4124127 ± 113 ± 6 (3 ± 5%)144122 (100%)11
-5137183 ± 110 ± 0 (0 ± 0%)144122 (100%)0.81
-6162238 ± 130 ± 0 (0 ± 0%)144122 (100%)0.71
-7187286 ± 130 ± 0 (0 ± 0%)144122 (100%)0.71
-8225327 ± 140 ± 0 (0 ± 0%)144122 (100%)0.71
-9262362 ± 140 ± 0 (0 ± 0%)144122 (100%)0.71
-10288391 ± 150 ± 0 (0 ± 0%)144122 (100%)0.71





novel miRNAs predicted by miRDeep2


provisional idthis is a provisional miRNA name assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the reported miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA candidate is a true positivethe estimated probability that a predicted novel miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. rfam alertthis field indicates if the predicted miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). total read countthis is the sum of read counts for the predicted mature, loop and star miRNAs. mature read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the predicted miRNA hairpin and are contained in the sequence covered by the predicted star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the excised potential miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
chr2_772 8.2 0.26 ± 0.44 23 15 0 8 no blast cgugauugucccgucuugcgagac ucuuucgagacguuauuaaguggc ucuuucgagacguuauuaaguggcagugugguggauauugucccacgugauugucccgucuugcgagac chr2:8144884..8144953:+
chr2_7835 2.6 0.44 ± 0.34 525 525 0 0 yes blast cgaggacuuagauuuuacggg cguaaaaucuaaguccucgcg cguaaaaucuaaguccucgcguuugaaaagugugugaaaauuaguccucuggcgaggaccugcuacacacacuuuuucaaacucgaggacuuagauuuuacggg chr2:14340208..14340312:-
chr2_11782 2.0 0.44 ± 0.34 7 4 0 3 yes blast uuuacauggucguucacuaucagu gaaugaaugaccaaaugaaauagc gaaugaaugaccaaaugaaauagccgaauguuuacauggucguucacuaucagu chr2:38735505..38735559:-
chr2_12561 2.0 0.44 ± 0.34 67 54 13 0 yes blast acuuuucacaucgguucagucagc caaccaaccgaugugaaaaguau acuuuucacaucgguucagucagccaaccgaugugaaauguauaccuuucacaucgguucagucaaccaaccgaugugaaaaguau chr2:43104006..43104092:-
chr2_7184 1.9 0.85 ± 0.08 18 18 0 0 yes blast ucuaaauucaugcaucgguuuccg aaaaccgaugcaugaauuuagauu aaaaccgaugcaugaauuuagauuaagguuagucuaaauucaugcaucgguuuccg chr2:8841456..8841512:-
chr2_1883 1.9 0.85 ± 0.08 73 73 0 0 yes blast ggauuuaagcaacucauaagcaa gcuuauuggguugcuuaaaugcua gcuuauuggguugcuuaaaugcuauucuggugggcccagacugccacaugggauuuaagcaacucauaagcaa chr2:18011278..18011351:+
chr2_135 1.9 0.85 ± 0.08 56 56 0 0 yes blast aucggauuuggggauugaaaaacc uucggauuuuuuuuacugaauccgauca uucggauuuuuuuuacugaauccgaucaccuucgguucggguaucggauuuggggauugaaaaacc chr2:1674335..1674401:+
chr2_983 1.9 0.85 ± 0.08 916 916 0 0 yes blast aggauuuaagcaacucauaagcaa gcuuguuggguugcuuaagugcuau gcuuguuggguugcuuaagugcuauucuggugggcccagacugccacauaggauuuaagcaacucauaagcaa chr2:9790117..9790190:+
chr2_10527 1.9 0.85 ± 0.08 25 25 0 0 yes blast ccuaaauuggaccaauggacccgc ggguugcuucgggucuagggac ccuaaauuggaccaauggacccgcauaaugucggguugcuucgggucuagggac chr2:36120685..36120739:-
chr2_761 1.9 0.85 ± 0.08 916 916 0 0 yes blast aggauuuaagcaacucauaagcaa gcuuguuggguugcuuaaaugcuau gcuuguuggguugcuuaaaugcuauucuggugggcccagacugccacauaggauuuaagcaacucauaagcaa chr2:8130911..8130984:+
chr2_10579 1.8 0.85 ± 0.08 25 25 0 0 yes blast ccuaaauuggaccaauggacccgc ggguugcuucgggucuagggac ccuaaauuggaccaauggacccgcauaaugucggguugcuucgggucuagggac chr2:36151746..36151800:-
chr2_3766 1.8 0.85 ± 0.08 29 29 0 0 yes blast acggaaaucgaugaaugaauuuag aaauucauuucuggauuuccgugu acggaaaucgaugaaugaauuuagaccaagguuaaaaacaaauucauuucuggauuuccgugu chr2:35214685..35214748:+
chr2_2438 1.8 0.85 ± 0.08 12 12 0 0 yes blast auuagcgacugauuuagcgacgga cgucgcuaauucggucgcuaaguu auuagcgacugauuuagcgacggauauaguagcgacugaaauuuccgucgcuaauucggucgcuaaguu chr2:23226796..23226865:+
chr2_9904 1.7 0.85 ± 0.08 916 916 0 0 yes blast aggauuuaagcaacucauaagcaa gcuaguugaguugcuuaaaugcuau gcuaguugaguugcuuaaaugcuauucugguggguccagacugccacauaggauuuaagcaacucauaagcaa chr2:33430893..33430966:-
chr2_3546 1.6 0.85 ± 0.08 19 19 0 0 yes blast aaagaaccaugauuuuagagggcc ccuucuaaaaucauuauucuuugg aaagaaccaugauuuuagagggccuaaaacuaauuuuuacauagucuuagguccuucuaaaaucauuauucuuugg chr2:33989605..33989681:+
chr2_315 1.6 0.85 ± 0.08 916 916 0 0 yes blast aggauuuaagcaacucauaagcaa gcuaguuggguugcuuaaaugcuau gcuaguuggguugcuuaaaugcuauucugguggguccagacugccacauaggauuuaagcaacucauaagcaa chr2:3729976..3730049:+
chr2_6657 1.5 0.85 ± 0.08 72 72 0 0 yes blast ccuuugaggaugaggccugcuc gcaggucuucuucuguagacgcu ccuuugaggaugaggccugcucgauuggcucuuucaacaauugaagagcagauugaagauuucucagcaggucuucuucuguagacgcu chr2:3887592..3887681:-
chr2_5779 1.4 0.85 ± 0.08 15 15 0 0 yes blast gaaccuuacauuggagaugcucuu cagcaccuccaaugguaaaguucuu cagcaccuccaaugguaaaguucuuaguucuuaguucuuaacucaaaaauaagaacuaagaaccuuacauuggagaugcucuu chr2:39741613..39741696:+
chr2_7280 1.3 0.85 ± 0.08 15 15 0 0 yes blast gaaccuuacauuggagaugcucuu cagcaccuccaaugguaaaguucuu cagcaccuccaaugguaaaguucuuaguucuuaguucuuaacuccaaaauaagaacuaagaaccuuacauuggagaugcucuu chr2:9281291..9281374:-
chr2_8393 1.2 0.85 ± 0.08 70 39 31 0 yes blast ugaguuauuuggcuucgggucggg cggcccaucccacauauauauuu ugaguuauuuggcuucgggucgggucggguuugaguugacauucgggccacccggcccaucccacauauauauuu chr2:19522446..19522521:-
chr2_2379 1.2 0.85 ± 0.08 156 156 0 0 yes blast accaggcucugauaccauga augguaucauaaccugcuuc augguaucauaaccugcuucacuuaguggucuuguguucaaauacugcucaagcacauggugaaccaggcucugauaccauga chr2:22969022..22969105:+
chr2_7894 1.1 0.85 ± 0.08 56 56 0 0 yes blast gaacugaguucuuaacuauuggag cuaaugcaagauuauuaguucuu cuaaugcaagauuauuaguucuuauuuuugaauuaagaacuaagaacugaguucuuaacuauuggag chr2:14540147..14540214:-
chr2_9927 1.0 0.85 ± 0.08 30 27 3 0 yes blast acaauguuauccuauccugcuggc cagcaggauaagauuacugcuauccua acaauguuauccuauccugcuggcgcaacaaacaacauauuacagcaggauaagauuacugcuauccua chr2:33665496..33665565:-
chr2_1631 0.9 0.70 ± 0.08 94 94 0 0 yes blast gauggacaggauaggauaggagac ucuauccuaacuccccccucag ucuauccuaacuccccccucaggauaacuuuuacacaugauggacaggauaggauaggagac chr2:15992008..15992070:+
chr2_1189 0.9 0.70 ± 0.08 11 11 0 0 yes blast aauuugggaggaaugggauggagc uccauuacuuucccccauuuuugu uccauuacuuucccccauuuuuguuuccccucaauuugggaggaaugggauggagc chr2:11399529..11399585:+
chr2_8279 0.9 0.70 ± 0.08 102 102 0 0 yes blast aaguguugugguaucguagcaagc uagcuaugagcccacuuau aaguguugugguaucguagcaagcaccuuguuuauaugcguauagguauagguacuagcuaugagcccacuuau chr2:18786851..18786925:-
chr2_2768 0.9 0.70 ± 0.08 184 184 0 0 yes blast auggaggagggagaugaccguugg agucaucaagcucucugaagaaa auggaggagggagaugaccguuggagccuuuuagagucacgugagaagcaugugacuuguccagucaucaagcucucugaagaaa chr2:26400960..26401045:+
chr2_12522 0.8 0.70 ± 0.08 57 57 0 0 yes blast gguaagaacuaggggacauaaggg cuucucgucccaaaggguuagcuca cuucucgucccaaaggguuagcucaagugguaagaacuaggggacauaaggg chr2:42592208..42592260:-
chr2_12200 0.8 0.70 ± 0.08 19 19 0 0 yes blast uuugggugugggauugauuaaa guuucaccugaauuauaaaacc guuucaccugaauuauaaaaccuauuuagguuugggugugggauugauuaaa chr2:39749763..39749815:-
chr2_6278 0.7 0.70 ± 0.08 301 301 0 0 yes blast aagaacuaagagcuccaugucagc aauuauuaguucuuaguucuuaa aagaacuaagagcuccaugucagcaccuccaaugguaaaauuauuaguucuuaguucuuaa chr2:44245233..44245294:+
chr2_3629 0.7 0.70 ± 0.08 153 109 44 0 yes blast gaagcaugugguaccaaguacaac cauauuuggucacgcaguucgg cauauuuggucacgcaguucggccaaauugccuaccucugcggcuauagaguagcuauagcuccuuuguauuacuuguggcaugaagcaugugguaccaaguacaac chr2:34715172..34715279:+
chr2_10084 0.7 0.70 ± 0.08 153 109 44 0 yes blast gaagcaugugguaccaaguacaac cauauuuggucacgcaguucgg cauauuuggucacgcaguucggccaaauugccuaccucugcggcuauagaguagcuauagcuccuuuguauuacuuguggcaugaagcaugugguaccaaguacaac chr2:34745607..34745714:-
chr2_8088 0.5 0.70 ± 0.08 59 59 0 0 yes blast ugggauaagugguuguuugacaug uuaaagugacccuuucccaac uuaaagugacccuuucccaacagcuuaaacuuuugggauaagugguuguuugacaug chr2:16587331..16587388:-
chr2_2779 0.5 0.70 ± 0.08 10 10 0 0 yes blast gaaccuuacauuggagaugcucua cagcaccuccaaugguaaaguucuu cagcaccuccaaugguaaaguucuuaguucuuaauucuuaacuccaaaauaagaacuaagaaccuuacauuggagaugcucua chr2:26529611..26529694:+
chr2_10111 0.4 0.70 ± 0.08 38 38 0 0 yes blast ucaggacaugauaggauaugauag aucauguuguguuauuuguuguuu ucaggacaugauaggauaugauaggauaauaaucauaucauguuguguuauuuguuguuu chr2:34881965..34882025:-
chr2_1081 0.4 0.70 ± 0.08 30 30 0 0 yes blast aguaaagaagucucacauuggaag uccgcuugagauggacuca uccgcuugagauggacucacacuugagggggagauuguugggaauucaagugugaguaaagaagucucacauuggaag chr2:10466479..10466557:+
chr2_9456 0.4 0.70 ± 0.08 33 33 0 0 yes blast augaguucuuaaccauugaagggg ccaauguaagguucuuaguucuuauuu ccaauguaagguucuuaguucuuauuuuuuaguuaagaacuaaaaaaugaguucuuaaccauugaagggg chr2:29623022..29623092:-
chr2_10124 0.4 0.70 ± 0.08 54 54 0 0 yes blast uuuacaacgguuguuagaauaagc uugagaauaugucugaugugaaaa uugagaauaugucugaugugaaaaguaauuaguaaacauuuuuuacaacgguuguuagaauaagc chr2:35061690..35061755:-
chr2_6002 0.1 0.70 ± 0.08 57 56 1 0 yes blast aggaccgaagagagagggaagcac ucuucuacccucuuccuccuua aggaccgaagagagagggaagcacaugaguugcacgugagaccugcaacggucaucuucuacccucuuccuccuua chr2:41118761..41118837:+
chr2_283 0.1 0.70 ± 0.08 57 54 0 3 yes blast uuuacaacgguuguuagaauaagc gggaauaugucugaugugaaaagu gggaauaugucugaugugaaaaguaauuaguaaacauuauuuacaacgguuguuagaauaagc chr2:3349965..3350028:+
chr2_5261 0 0.70 ± 0.08 22 22 0 0 yes blast uuagauuucgauccucauuggaga ucuaauaggggaucuuauuagguccaaau ucuaauaggggaucuuauuagguccaaaucuuaauuauuuuaagaucuuagauuucgauccucauuggaga chr2:38506651..38506722:+
chr2_5614 0 0.70 ± 0.08 21 21 0 0 yes blast aaagaaccaugauuuuagagg uuuuuuaucaugucuuugg aaagaaccaugauuuuagagggaccuaaaacucauuuuuuaucaugucuuugg chr2:39299766..39299819:+
chr2_8583 0 0.70 ± 0.08 429 429 0 0 yes blast ugacggaacggaacaggacagaac uguguuugguaacuccaagucaau ugacggaacggaacaggacagaacagaaugaaacaugacaauaauguucuauguguuguguuugguaacuccaagucaau chr2:21129027..21129107:-
chr2_11538 0 0.70 ± 0.08 22 22 0 0 yes blast uuagauuucgauccucauuggaga ucuaauaggggaucuuauuagguccaaau ucuaauaggggaucuuauuagguccaaaucuuaauuauuuuaagaucuuagauuucgauccucauuggaga chr2:38419014..38419085:-
chr2_4851 0 0.70 ± 0.08 15 15 0 0 yes blast agaguuugguagagcuuagauaga uaaauaggcucauucugaaccuug uaaauaggcucauucugaaccuuguuaaagagaguuugguagagcuuagauaga chr2:37732605..37732659:+



mature miRBase miRNAs detected by miRDeep2


tag idthis is a tag id assigned by miRDeep2. The first part of the id designates the chromosome or genome contig on which the miRNA gene is located. The second part is a running number that is added to avoid identical ids. The running number is incremented by one for each potential miRNA precursor that is excised from the genome. Clicking this field will display a pdf of the structure, read signature and score breakdown of the miRNA. miRDeep2 scorethe log-odds score assigned to the hairpin by miRDeep2 estimated probability that the miRNA is a true positivethe estimated probability that a predicted miRNA with a score of this or higher is a true positive. To see exactly how this probability is estimated, mouse over the 'novel miRNAs, true positives' in the table at the top of the webpage. For miRBase miRNAs, this reflects the support that the data at hand lends to the miRNA. rfam alertthis field indicates if the miRNA hairpin has sequence similarity to reference rRNAs or tRNAs. Warnings in this field should overrule the estimated probability that a reported miRNA is a true positive (previous field). predicted mature seq. in accordance with miRBase mature seq.If the predicted miRDeep2 sequence overlaps with the miRBase annotated mature sequence than this is indicated by 'TRUE'. If the predicted miRDeep2 star sequence overlaps with the miRBase annotated mature sequence this is inidicated by 'STAR'. total read countthis is the sum of read counts for the mature, loop and star miRNAs. mature read countthis is the number of reads that map to the miRNA hairpin and are contained in the sequence covered by the consensus mature miRNA, including 2 nts upstream and 5 nts downstream. loop read countthis is the number of reads that map to the miRNA hairpin and are contained in the sequence covered by the consensus miRNA loop, including 2 nts upstream and 5 nts downstream. star read countthis is the number of reads that map to the miRNA hairpin and are contained in the sequence covered by the consensus star miRNA, including 2 nts upstream and 5 nts downstream. significant randfold p-valuethis field indicates if the estimated randfold p-value of the miRNA hairpin is equal to or lower than 0.05 (see Bonnet et al., Bioinformatics, 2004). mature miRBase miRNAthis field displays the ids of any reference mature miRNAs for the species that map perfectly (full length, no mismatches) to the reported miRNA hairpin. If this is the case, the reported miRNA hairpin is assigned as a known miRNA. If not, it is assigned as a novel miRNA. If more than one reference mature miRNA maps to the miRNA hairpin, then only the id of the reference miRBase miRNA that matches the predicted mature sequence is output. example miRBase miRNA with the same seedthis field displays the ids of any reference mature miRNAs from related species that have a seed sequence identical to that of the reported mature miRNA. The seed is here defined as nucleotides 2-8 from the 5' end of the mature miRNA. If more than one reference mature miRNA have identical seed, then only the id of the miRNA that occurs last in the input file of reference mature miRNAs from related species is displayed. UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the consensus precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the consensus precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). consensus mature sequencethis is the consensus mature miRNA sequence as inferred from the deep sequencing reads. consensus star sequencethis is the consensus star miRNA sequence as inferred from the deep sequencing reads. consensus precursor sequencethis is the consensus precursor miRNA sequence as inferred from the deep sequencing reads. Note that this is the inferred Drosha hairpin product, and therefore does not include substantial flanking genomic sequence as does most miRBase precursors. precursor coordinateThe given precursor coordinates refer do absolute position in the mapped reference sequence
chr2_10721 5.6e+1 0.00 ± 0.00 TRUE 109 77 0 32 yes ath-miR393a blast uccaaagggaucgcauugaucc ucaugcuaucccuuuggauuc uccaaagggaucgcauugaucccaaaucuugaucuauuuuuccauuuuuacaauauuugagaucaugcuaucccuuuggauuc chr2:36423384..36423467:-


mature miRBase miRNAs not detected by miRDeep2


miRBase precursor idClicking this field will display a pdf of the structure and read signature of the miRNA. total read countthis is the sum of read counts for the mature and star miRNAs. mature read count(s)this is the number of reads that map to the miRNA hairpin and are contained in the sequence covered by the mature miRNA, including 2 nts upstream and 5 nts downstream. If more than one mature sequence is given this will be a comma separated list. In parenthesis are normalized read counts shown. star read countthis is the number of reads that map to the miRNA hairpin and are contained in the sequence covered by the star miRNA, including 2 nts upstream and 5 nts downstream. This field is empty unless a reference star miRNA was given as input to quantifier.pl. If more than one mature sequence is given this will be a comman separated list remaining readsthis is the number of reads that did not map to any of the mature and star sequences UCSC browserif a species name was input to miRDeep2, then clicking this field will initiate a UCSC blat search of the miRNA precursor sequence against the reference genome. NCBI blastnclicking this field will initiate a NCBI blastn search of the miRNA precursor sequence against the nr/nt database (non-redundant collection of all NCBI nucleotide sequences). miRBase mature sequence(s)this is/are the mature miRNA sequence(s) input to quantifier.pl. miRBase star sequence(s)this is/are the star miRNA sequence(s) input to quantifier.pl. This field is empty unless a reference star miRNA was given as input to quantifier.pl. miRBase precursor sequencethis is the precursor miRNA sequence input to quantifier.pl.
ath-MIRf10114-akr 183 183
- 0 - blast
uccaaagggaucgcauugaucc
gaucaugcuaucucuuugga
uccaaagggaucgcauugaucc
-gaggaaggauccaaagggaucgcauugauccuaauuaaggugaauucuccccauauuuucuuuauaauuggcaaauaaaucacaaaaauuugcuugguuuuggaucaugcuaucucuuuggauucauccuu
ath-MIRf10567-akr 24 24
- 0 - blast
ugacagaagagagugagcac
ugacagaagagagugagcac
gcgugcucacucucuuuuug
ugacagaagagagugagcac
ugacagaagagagugagcac
ugacagaagagagugagcac
ugacagaagagagugagcac
-gaaguugacagaagagagugagcacacaaaggggaaguuguauaaaaguuuuguauaugguugcuuuugcgugcucacucucuuuuugucauaacuuc
ath-MIR156g 4 4
- 0 - blast
cgacagaagagagugagcac
-auaacgaaggcgacagaagagagugagcacacauggcucuuuuucuagcaugcucaugcucgaaagcucugcgugcuuacucucuucuugucuccugcucucu
ath-MIRf10257-akr 24 24
- 0 - blast
ugacagaagagagugagcac
ugacagaagagagugagcac
ugacagaagagagugagcac
ugacagaagagagugagcac
ugacagaagagagugagcac
gugugcucacucucuauccg
ugacagaagagagugagcac
gcuaugugugcucacucucu
-ggugacagaagagagugagcacacaugguggcuuucuugcauauuugaagguuccaugcuugaagcuaugugugcucacucucuauccgucacc